Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 6727810
End position: 6727833
Length: 24

DNA sequence
>NC_014640, from 6727810 to 6727833 (24 bp); Achromobacter xylosoxidans A8 GACCATGTCCATGACCACGATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6727112-6728230	Sequence	AXYL_06255 - CobW/HypB/UreG, nucleotide-binding domain-containing protein 5