Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 6721969
End position: 6721992
Length: 24

DNA sequence
>NC_014640, from 6721969 to 6721992 (24 bp); Achromobacter xylosoxidans A8 ATCGTGGTCGTGATGGTGATCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6721589-6722662	Sequence	AXYL_06249 - high-affinity nickel-transport family protein (Protein is coded in complementary strand; from 6722662 to 6721589)