Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 654064
End position: 654087
Length: 24

DNA sequence
>NC_014640, from 654064 to 654087 (24 bp); Achromobacter xylosoxidans A8 CCTGGCCCTGGGCCAGGCCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 653814-654902	Sequence	AXYL_00614 - ABC transporter (Protein is coded in complementary strand; from 654902 to 653814)