Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 6512307
End position: 6512330
Length: 24

DNA sequence
>NC_014640, from 6512307 to 6512330 (24 bp); Achromobacter xylosoxidans A8 CGGCGCCGGCGTCTGCGCTGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6512116-6513084	Sequence	AXYL_06042 - extra-cytoplasmic solute receptor family protein 170 (Protein is coded in complementary strand; from 6513084 to 6512116)