Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 642650
End position: 642673
Length: 24

DNA sequence
>NC_014640, from 642650 to 642673 (24 bp); Achromobacter xylosoxidans A8 GACGGCGATGGCGTCGGCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 642561-643226	Sequence	AXYL_00601 thiE thiamine-phosphate pyrophosphorylase (Protein is coded in complementary strand; from 643226 to 642561)