Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 6230445
End position: 6230468
Length: 24

DNA sequence
>NC_014640, from 6230445 to 6230468 (24 bp); Achromobacter xylosoxidans A8 CCGCCCCCGCTCCCGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6229541-6230560	Sequence	AXYL_05789 - extra-cytoplasmic solute receptor family protein 157 (Protein is coded in complementary strand; from 6230560 to 6229541)