Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5985478
End position: 5985501
Length: 24

DNA sequence
>NC_014640, from 5985478 to 5985501 (24 bp); Achromobacter xylosoxidans A8 CGGCGGCGGCAGCGCCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5984724-5986547	Sequence	AXYL_05591 - tetratricopeptide repeat family protein 11 (Protein is coded in complementary strand; from 5986547 to 5984724)