Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5639715
End position: 5639738
Length: 24

DNA sequence
>NC_014640, from 5639715 to 5639738 (24 bp); Achromobacter xylosoxidans A8 CGGCGGCGGCGCGGGCGGCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5638616-5639866	Sequence	AXYL_05263 kynU kynureninase (Protein is coded in complementary strand; from 5639866 to 5638616)