Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5547739
End position: 5547762
Length: 24

DNA sequence
>NC_014640, from 5547739 to 5547762 (24 bp); Achromobacter xylosoxidans A8 CAGGTCCAGCTCCAGGCCCAGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5547605-5548108	Sequence	AXYL_05177 - alkyl hydroperoxide reductase (Protein is coded in complementary strand; from 5548108 to 5547605)