Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5540302
End position: 5540325
Length: 24

DNA sequence
>NC_014640, from 5540302 to 5540325 (24 bp); Achromobacter xylosoxidans A8 CCGCGGCCACGGCCGCGACCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5540091-5541146	Sequence	AXYL_05166 - aldo/keto reductase (Protein is coded in complementary strand; from 5541146 to 5540091)