Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5366712
End position: 5366735
Length: 24

DNA sequence
>NC_014640, from 5366712 to 5366735 (24 bp); Achromobacter xylosoxidans A8 CCGCGCCGGCGCCAGCGCCCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5366210-5367250	Sequence	AXYL_04998 - NMT1/THI5-like domain-containing protein (Protein is coded in complementary strand; from 5367250 to 5366210)