Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5280840
End position: 5280863
Length: 24

DNA sequence
>NC_014640, from 5280840 to 5280863 (24 bp); Achromobacter xylosoxidans A8 CGCCCATGCCCACGCCGACGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5257568-5289505	Sequence	AXYL_04928 - hemolysin-type calcium-binding repeat family protein 4 (Protein is coded in complementary strand; from 5289505 to 5257568)