Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5217773
End position: 5217796
Length: 24

DNA sequence
>NC_014640, from 5217773 to 5217796 (24 bp); Achromobacter xylosoxidans A8 CCACCGCCAGCGCCACGGCCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5216029-5217843	Sequence	AXYL_04892 - inner-membrane translocator (Protein is coded in complementary strand; from 5217843 to 5216029)