Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4996155
End position: 4996178
Length: 24

DNA sequence
>NC_014640, from 4996155 to 4996178 (24 bp); Achromobacter xylosoxidans A8 ACATCAACTTCAACAGCAACACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4995606-4996295	Sequence	AXYL_04680 irlR4 transcriptional activator protein IrlR 4