Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4888784
End position: 4888807
Length: 24

DNA sequence
>NC_014640, from 4888784 to 4888807 (24 bp); Achromobacter xylosoxidans A8 CCTGCGCCAGCGCCTGCTCCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4888660-4889748	Sequence	AXYL_04562 - imelysin (Protein is coded in complementary strand; from 4889748 to 4888660)