Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4703934
End position: 4703957
Length: 24

DNA sequence
>NC_014640, from 4703934 to 4703957 (24 bp); Achromobacter xylosoxidans A8 CAGGATCACGATCACGATCAGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4703476-4704366	Sequence	AXYL_04400 - inner-membrane translocator (Protein is coded in complementary strand; from 4704366 to 4703476)