Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4542123
End position: 4542146
Length: 24

DNA sequence
>NC_014640, from 4542123 to 4542146 (24 bp); Achromobacter xylosoxidans A8 CAGCACCAGCAGCAGTACCAACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4541779-4542555	Sequence	AXYL_04257 - hypothetical protein (Protein is coded in complementary strand; from 4542555 to 4541779)