Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4526720
End position: 4526743
Length: 24

DNA sequence
>NC_014640, from 4526720 to 4526743 (24 bp); Achromobacter xylosoxidans A8 CCAGCGCCAGCATCAGCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4526164-4527072	Sequence	AXYL_04238 - RNA polymerase sigma factor sigma-70 family protein (Protein is coded in complementary strand; from 4527072 to 4526164)