Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4306422
End position: 4306445
Length: 24

DNA sequence
>NC_014640, from 4306422 to 4306445 (24 bp); Achromobacter xylosoxidans A8 GCCCCGCCGCCCCGCTGCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4304907-4307036	Sequence	AXYL_04011 - hypothetical protein (Protein is coded in complementary strand; from 4307036 to 4304907)