Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4162695
End position: 4162718
Length: 24

DNA sequence
>NC_014640, from 4162695 to 4162718 (24 bp); Achromobacter xylosoxidans A8 CACGGCCACCGCAACGGCTACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4161874-4163151	Sequence	AXYL_03869 - ribulose bisphosphate carboxylase large chain, catalytic domain-containing protein