Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4140597
End position: 4140620
Length: 24

DNA sequence
>NC_014640, from 4140597 to 4140620 (24 bp); Achromobacter xylosoxidans A8 GGCCAGGGCCTGGGACAGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4140355-4141290	Sequence	AXYL_03851 - alpha/beta hydrolase (Protein is coded in complementary strand; from 4141290 to 4140355)