Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 411645
End position: 411668
Length: 24

DNA sequence
>NC_014640, from 411645 to 411668 (24 bp); Achromobacter xylosoxidans A8 CCAGCACCACCAGCAGCACCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 411218-412135	Sequence	AXYL_00391 dppC2 peptide ABC transporter permease (Protein is coded in complementary strand; from 412135 to 411218)