Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3892561
End position: 3892584
Length: 24

DNA sequence
>NC_014640, from 3892561 to 3892584 (24 bp); Achromobacter xylosoxidans A8 CACCTGCACCTGCACCCGCCCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3891578-3892978	Sequence	AXYL_03631 - His Kinase A phosphoacceptor domain-containing protein 9 (Protein is coded in complementary strand; from 3892978 to 3891578)