Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3850860
End position: 3850883
Length: 24

DNA sequence
>NC_014640, from 3850860 to 3850883 (24 bp); Achromobacter xylosoxidans A8 CGCCAGCGCCGGCGCCACCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3850300-3851196	Sequence	AXYL_03583 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 3851196 to 3850300)