Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3804162
End position: 3804185
Length: 24

DNA sequence
>NC_014640, from 3804162 to 3804185 (24 bp); Achromobacter xylosoxidans A8 CAGCACCTGCACCAGCAGCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3803680-3804369	Sequence	AXYL_03535 - amino ABC transporter permease, 3-TM region, His/Glu/Gln/Arg/opine family domain-containing protein 11 (Protein is coded in complementary strand; from 3804369 to 3803680)