Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3642772
End position: 3642795
Length: 24

DNA sequence
>NC_014640, from 3642772 to 3642795 (24 bp); Achromobacter xylosoxidans A8 GCGGCCACGGCCGCCGCCGCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3641860-3642849	Sequence	AXYL_03380 - inner-membrane translocator (Protein is coded in complementary strand; from 3642849 to 3641860)