Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3233470
End position: 3233493
Length: 24

DNA sequence
>NC_014640, from 3233470 to 3233493 (24 bp); Achromobacter xylosoxidans A8 TCGCTGTCGCCGTCGCCGTTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3233213-3234022	Sequence	AXYL_03024 - amino ABC transporter permease, 3-TM region, His/Glu/Gln/Arg/opine family domain-containing protein 8