Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3072676
End position: 3072699
Length: 24

DNA sequence
>NC_014640, from 3072676 to 3072699 (24 bp); Achromobacter xylosoxidans A8 CGCTGCTGCTGCTGCTGCTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3072367-3073893	Sequence	AXYL_02874 - adenylate cyclase (Protein is coded in complementary strand; from 3073893 to 3072367)