Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2921983
End position: 2922006
Length: 24

DNA sequence
>NC_014640, from 2921983 to 2922006 (24 bp); Achromobacter xylosoxidans A8 CCCCGAGCCCGACTCCGAACCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2921654-2922529	Sequence	AXYL_02728 - hypothetical protein (Protein is coded in complementary strand; from 2922529 to 2921654)