Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 271816
End position: 271839
Length: 24

DNA sequence
>NC_014640, from 271816 to 271839 (24 bp); Achromobacter xylosoxidans A8 AGGCCGATGCCGATGCCGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 270271-272373	Sequence	AXYL_00258 - CoA-binding protein (Protein is coded in complementary strand; from 272373 to 270271)