Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2651387
End position: 2651410
Length: 24

DNA sequence
>NC_014640, from 2651387 to 2651410 (24 bp); Achromobacter xylosoxidans A8 CTGCAGTTGCAGCTGCCGCTGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2650710-2652446	Sequence	AXYL_02502 - phenylalanine and histidine ammonia-lyase family protein 1 (Protein is coded in complementary strand; from 2652446 to 2650710)