Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2604332
End position: 2604355
Length: 24

DNA sequence
>NC_014640, from 2604332 to 2604355 (24 bp); Achromobacter xylosoxidans A8 GGAAGCGGAAGCCGAAGCCGAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2604061-2605023	Sequence	AXYL_02459 - 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain-containing protein 2 (Protein is coded in complementary strand; from 2605023 to 2604061)