Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2547264
End position: 2547287
Length: 24

DNA sequence
>NC_014640, from 2547264 to 2547287 (24 bp); Achromobacter xylosoxidans A8 CAGGGCGAGGGCCAGCGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2546320-2547819	Sequence	AXYL_02404 - major facilitator protein (Protein is coded in complementary strand; from 2547819 to 2546320)