Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2536075
End position: 2536098
Length: 24

DNA sequence
>NC_014640, from 2536075 to 2536098 (24 bp); Achromobacter xylosoxidans A8 CCAGCGCCACCGCCAGCACCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2535597-2536220	Sequence	AXYL_02393 - lysine transporter LysE (Protein is coded in complementary strand; from 2536220 to 2535597)