Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2347027
End position: 2347050
Length: 24

DNA sequence
>NC_014640, from 2347027 to 2347050 (24 bp); Achromobacter xylosoxidans A8 CCAGCACCAGCCCCAGGACCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2345529-2347502	Sequence	AXYL_02220 - diguanylate cyclase (Protein is coded in complementary strand; from 2347502 to 2345529)