Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2281432
End position: 2281455
Length: 24

DNA sequence
>NC_014640, from 2281432 to 2281455 (24 bp); Achromobacter xylosoxidans A8 GCGGCGTCGGCGCCGGCGGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2279716-2281467	Sequence	AXYL_02159 - type II/IV secretion system family protein 1