Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2080396
End position: 2080419
Length: 24

DNA sequence
>NC_014640, from 2080396 to 2080419 (24 bp); Achromobacter xylosoxidans A8 AGCCCGAGCCGGAGCCTGAACCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2080099-2080908	Sequence	AXYL_01961 - TonB family C-terminal domain-containing protein 2