Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1800810
End position: 1800833
Length: 24

DNA sequence
>NC_014640, from 1800810 to 1800833 (24 bp); Achromobacter xylosoxidans A8 GATCAGGATCAGGAGCAGGATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1800766-1802979	Sequence	AXYL_01689 - hypothetical protein (Protein is coded in complementary strand; from 1802979 to 1800766)