Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1667045
End position: 1667068
Length: 24

DNA sequence
>NC_014640, from 1667045 to 1667068 (24 bp); Achromobacter xylosoxidans A8 CAACCGCAACCCCAACGGCAACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1665832-1667325	Sequence	AXYL_01573 mmsA2 methylmalonate-semialdehyde dehydrogenase (acylating) 2