Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1627990
End position: 1628013
Length: 24

DNA sequence
>NC_014640, from 1627990 to 1628013 (24 bp); Achromobacter xylosoxidans A8 CGGCGGCTGCGGCGGCGGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1627243-1630326	Sequence	AXYL_01534 rne ribonuclease E (Protein is coded in complementary strand; from 1630326 to 1627243)