Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1518281
End position: 1518304
Length: 24

DNA sequence
>NC_014640, from 1518281 to 1518304 (24 bp); Achromobacter xylosoxidans A8 GTGGCGCTGGCGGTGGCGCTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1518246-1519376	Sequence	AXYL_01440 - RND family efflux transporter MFP subunit 5