Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1308664
End position: 1308687
Length: 24

DNA sequence
>NC_014640, from 1308664 to 1308687 (24 bp); Achromobacter xylosoxidans A8 CCAGCACCAGCACCGGCAACAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1306545-1308767	Sequence	AXYL_01237 - hypothetical protein (Protein is coded in complementary strand; from 1308767 to 1306545)