Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 126460
End position: 126483
Length: 24

DNA sequence
>NC_014640, from 126460 to 126483 (24 bp); Achromobacter xylosoxidans A8 CCAGGCACAGGCCCACGCCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 126420-126752	Sequence	AXYL_00118 - hypothetical protein (Protein is coded in complementary strand; from 126752 to 126420)