Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1264273
End position: 1264296
Length: 24

DNA sequence
>NC_014640, from 1264273 to 1264296 (24 bp); Achromobacter xylosoxidans A8 ACCAGCGCCAGCGCCAGCACCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1263052-1264854	Sequence	AXYL_01194 kdpA K+-transporting ATPase A (Protein is coded in complementary strand; from 1264854 to 1263052)