Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1047564
End position: 1047587
Length: 24

DNA sequence
>NC_014640, from 1047564 to 1047587 (24 bp); Achromobacter xylosoxidans A8 TCGTCCTCGTCATCCTCCGCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1047489-1048022	Sequence	AXYL_00970 - hypothetical protein (Protein is coded in complementary strand; from 1048022 to 1047489)