Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 969033
End position: 969059
Length: 27

DNA sequence
>NC_014538, from 969033 to 969059 (27 bp); Thermoanaerobacter sp. X513 TAAATAAAATATATAAAATACATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 968527-969876	Sequence	Thet_0963 - SEC-C motif domain-containing protein (Protein is coded in complementary strand; from 969876 to 968527)