Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 645069
End position: 645101
Length: 33

DNA sequence
>NC_014538, from 645069 to 645101 (33 bp); Thermoanaerobacter sp. X513 AAAAAGCCAATAAAAAGCGTATAAAAAGAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 644348-645208	Sequence	Thet_0637 - hypothetical protein (Protein is coded in complementary strand; from 645208 to 644348)