Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 2291843
End position: 2291867
Length: 25

DNA sequence
>NC_014538, from 2291843 to 2291867 (25 bp); Thermoanaerobacter sp. X513 AATATAAAATAGTATAATCTAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2291437-2292963	Sequence	Thet_2328 - peptidoglycan-binding lysin domain-containing protein (Protein is coded in complementary strand; from 2292963 to 2291437)