Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 2245943
End position: 2245972
Length: 30

DNA sequence
>NC_014538, from 2245943 to 2245972 (30 bp); Thermoanaerobacter sp. X513 TCCATTATTTTCCATTCATTTCCCTCATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2245847-2246458	Sequence	Thet_2287 - hypothetical protein (Protein is coded in complementary strand; from 2246458 to 2245847)