Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 2179951
End position: 2179975
Length: 25

DNA sequence
>NC_014538, from 2179951 to 2179975 (25 bp); Thermoanaerobacter sp. X513 TTTTCTTTTTTTCTCTGTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2179666-2180106	Sequence	Thet_2218 - hypothetical protein (Protein is coded in complementary strand; from 2180106 to 2179666)